CPlasFal_708


Sequence

>CPlasFal_708 (2 EST) Length=659 ACATTAAACATGTTTTAATAGAAGAGGTTCCTAAAGAATTTGAACAAAATAATCCTTTTAATTATAAACATTCCAAATAT AATTTTACTAAAGAAATAGGTAATAATATCTTCATCTATCTTTTTTGGACATATGCAAAACTTGTTTAACTATATCTTTT ATTTTGNGTGTCTTCTTTTGGTTATACAAATAGTGTTAATACTTTTATATATATATATCAAAACTAATGATGAAGTTTCT ATAATACTCAAGGATATGGAGCATACCGAGGAAATGTCTAAGTATCTTAAGAGACTATCAAAATATATGCTGAATAAAAA GTATGTTAATACGAACATACAACATTTTAAAGCAGGCAGGCACGTGAGTAGTGTTAATTAGTATAAAAAAAATAAAAAAT AAAAAAAAAAAAAAAAATATATATATATATATGGATATATTTACGGATATATATTTATATTTANGTTTATANGGAAGGAA TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTTCTTGTTCTTCATTTTTTTTTTTTTTTTTTTTGTGAATAATTAACA CATCCTCACCACTTACATATGTTTTCATATTTTATACTATGATTCACTTTGTTTTGTTTATATTTTCTTTTAAAACAAAA TTTATATTTTTAGTTAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_708: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12001042320346AA5500941193m3gmbPfHB3.1, G. Roman Reddy
12003002320542AA5502901419m3gmbPfHB3.1, G. Roman Reddy


Date: 10:43:28 on Sat 18 Nov 117.