CPlasFal_709


Sequence

>CPlasFal_709 (2 EST) Length=705 CAACATCTTATTAATTCTTAAAACGTGGAAAGGATGTATTCTTACTCTTAAGTGGAAATTATCTTTACCACAATTGGTAA TCATATATTTGTTTGCACTAATACGTGCAGCTTCTAAAGCTTCAGATGATATCTGTTCATATTCGTAAGATACTAAATGT NCTACACCGCTAAATTCATTGACATCAGCTTTCTTTCTACCCATATCATAAATTCTTATCTTAGGGTCAGGAACACCTCN ACAGTAACGACTCTTTGGGTAGGGTTTATTTTTACAGTACCTATAACACCTTGCTGGTCTTCTTCCCATCTTGTTAATTT ATATAAAAAAAAATATATATATTCAAGAAGTTGTTCTTATATAATTTTTATTTTTTTATTTTTTAATTTTTTAATTTTTT GTCCCTTTTATTTAATAATTTTTTCCATATAATGCATATACACAAACTAAAGAAGAAAATTAAAAAGAAGAAGGAAGGGA AGTACCTAACAAAAAAACACATCCTAAGGAAATTATTTTTGAATGAAGAAGAATTTCGTAAGCTTTGTATTTTTAAAGGA ATATATCCAAAAGATTTTAAAGAAATTCCTTTGAAATATCGAAAAANATTTNATAAACATAAAGTGTTTTATACTAGGNA TTGATTTTTTAAAATTATCACATGNAAANNTAATTAATGGNTTTTNGGGAAANTAAAAATATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_709: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28934319670T098380415m3gmbPfHB3.1, G. Roman Reddy
5045891674773N977551201C3czapPFDd2.1, Debopam Chakrabarti


Date: 15:22:35 on Fri 24 Nov 117.