CPlasFal_711


Sequence

>CPlasFal_711 (2 EST) Length=649 NNCGATGGTNTATTTTCANCCCNNTTGGACAAAAATAGACCACCNTGNTTAGTGGAATAATACCTTTAAAAAANCGTATA TTTAAAAANCTTNAATTTCANATGNTGTTNATATACATAAATGCTATTGGGATCCTCTAAATGACGATCAAAAAGAAGCA CAGCTGATTAAAATTATAGAAACATTTCAACAAAAGCAAGATCCGAAAACAAAAACGGAATCCAAAGAATTATATGAAGA AAAATATTTTGATTCAAATATACTACATCTTAAACATAAGAGAGTTAAATTTCATACTTGGCCACCAGAAAATATAACAA TTTGAAAAAATGAAAATATTCCAAAATAGAGGGAAATGTAGGTCTTTGAATTTTCTCCACATTAACGTATATATATATAT ATATATATTCACCTAATGTCTTCTTTTATGGGACCATGATGATGATCTTGAGTTGGTTCTTGATCTTGATCTTGATTTTG ATATGGTTCTATTATTTCTCCTTCTTTCTTGGTATGATAAACTTCTTGAATAACTTCTTTTTTTATCATAAGTATCTCTT CTTCTGTCCATACTTCTACTTCTACTTCGACTACTTGAGCTTCTACTTCTACTATAACTTCTGCTACTGTAGCTTCTACT TCTGCTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_711: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28757319493T096610234m3gmbPfHB3.1, G. Roman Reddy
44126462873T180870481c3cbsPfHB3.1, Debopam Chakrabarti


Date: 8:26:28 on Fri 24 Nov 117.