CPlasFal_714


Sequence

>CPlasFal_714 (3 EST) Length=636 ATGCAAATACAATTTTTAACATTGTCAACGGATAAAAATGATAAAGCAACAACAGCAGCATGTACTCTATCTAATTCGTG TGATTTTAATAAAGTTATAAAAACGGCTATTCCATTTGCCTCACGTATTGCATCTTTATAATGTGGCTCGTTTTCTTTGC TAGCTAAAATTGCCAATTGAGTTGCGGATAATGCACCAATAGTTTTGGGGTCAGCAGCCCAAGGATGCATTCTATCTTCT AATTTTTCTATTTCGCATGTTGAAGAACATAAGTTTACAAACTCTTGAACATCATTTTCATCATACGCTTTATCAAATCT GAGAATATCATTACTTGTGAAGGATAACAACTTTCTTATTGTCTTGGATCCTTCTATACCAAACTCTTGTAGTTTATTTT TATAAAGTAAATCTCTTCCTGCACAGCAATTATTTCCCATAATTTCTTTGGGTTTCTTATAAAAATATTATTAATTTTTT AATTAAACCTAAAACATAATCATATGTTTTTTCTATCTGACAATGTGTACATATATGTATATACTTATATATACATATAC GTTTTTAATTTGAAAACCTATTTTCCTCTTATAAAAAAGAATTCAAAAGATATACAAATATGAATTAGCAGAAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_714: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045421674726N976921118C3czapPFDd2.1, Debopam Chakrabarti
5047751674959N979411576C3czapPFDd2.1, Debopam Chakrabarti
5048031674987N979531714C3czapPFDd2.1, Debopam Chakrabarti


Date: 20:0:14 on Sat 18 Nov 117.