CPlasFal_719


Sequence

>CPlasFal_719 (3 EST) Length=559 GGCATCAAGGTATAAATTTGTGAAAAAATAAAAAAATAAATATTTGGATGCTTCAGCAGCAAGTCCGTGAGTAAAGAAAA AACTTCCAGGAGCTCTATAGTTAGTACATTTTTCTAAACCCGCACTAGGACAAGTTCCAGAAGCATCCTTTCCCTTAGGA GTTTGACCGTATTCAGGATCTGTTAATTGGGGAATTAAATGTTGTCCAGTTGTAATAGCGTGTGTCCAACTAATTCTCAT TACTAGAAAATATGTAGTTATGGGTAAAAATTTTCTTCCAATAAATTGCCCTACCTTTTTAGCAGAGTAGAAATTTGCAC TTGCTACCGCCTGATATTCACACAAAAGACTTAAATTTTTATAATTTAACATATCATACATTTTGGATGCTAGCATGAAA TAGTTTGAGAAAACGAAGGTTTTTCCATATTTTAATTGTGTTATAGGTTTTTTCGCATATGGCGGCAATAAACTGTTAGT GATACTATCCATGATACTTCCGTTATATACATATGCAAAAGTAAGAAAAGCGGAAGTACTTGTTGCTACTTGGATATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_719: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045231674707N981501088C3czapPFDd2.1, Debopam Chakrabarti
5047551674939N979211540C3czapPFDd2.1, Debopam Chakrabarti
5047961674980N979461707C3czapPFDd2.1, Debopam Chakrabarti


Date: 14:54:51 on Wed 22 Nov 117.