CPlasFal_727


Sequence

>CPlasFal_727 (2 EST) Length=403 GGGCAACTACCCATACCTAAAATCCAAGCTTTAAATGAAGCTGAAATGTTAAGAGTTGTTAAATCAGGAAAAAGAAGAAG AAAAACTTGGAAAAGATTAATAGATAAAATATCTTTTGTGGGTAATGATTTCACAAGAAAAAATCCAAAATTCGAAAGAT ATATACGTCCAAGTAGTTTAAGATTCAAAAAAGCAAATGTTTATCATAGTGAATTGAAATCAACATTTTCTTTAGATATT ATTAGTGTTAAGGTAAATCCACAATCAAACCTTTATACAAATCTTGGGATTATAACCAAAGGTACTATCATAGAAGTTAA TGTAAGCGAACTAGGGTTAGTTACGCAATCAGGAAAAGGTATATGGGCAAAATTTGCTCAAGTTACAAATAATCCTGAAT TAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_727: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44222462969T181830790c3czapPFDd2.1, Debopam Chakrabarti
5049671675151N981012180C3czapPFDd2.1, Debopam Chakrabarti


Date: 4:44:36 on Sat 25 Nov 117.