CPlasFal_735


Sequence

>CPlasFal_735 (20 EST) Length=2576 CCATTATTAGTAGTACTAGTACTTGCACTATTTGTACTACTTTGACTTCCACTAGCAATAGTATCAGCATTTGGAGCATT TGCACCTACACTAGTAGTATTAGAACCTTCATTTGCCATACTTCTCCTTATACTCATATTATAAGCATTGTTTATGAATG TGTTGCTATATTTACTTTCATTTTTAATATTAAAGGTAACAAAAATAAAGAAATTTATAATAGACAATGTTTTAATTACC TTCATTTTGACTAATATAATATGTTAAGAATTAATAAATACAATTCTTTTAAATTAATTATTAAAAAATATTAAATTACA AAATGAAATTTAATATAATTAATATTTTATTATTATTAATAAATGAATAAATATTTAATATTTACTTAAATATATATACA TATATATATATATATATTTTTTCCTTTATGATTAACATATGAATATATTTATATTTCCTTTTTCAGGTGAGTTGAACATA AAAGCTATTCATGCACCTTGTCATACGAAGGGACACATTTTATATTATGTATACAAAACTGATGAAGCAAAACAAGAAGA TCATAAATACAAACCAATATTATTTACTGGGGATACATTGTTTATAGCTGGGTGTGGAAGATTTTTTGAAGGAAGTGCAA AGGATATGTTTAAAAATATTGAAAAAGTAAAAAACATGAGAAAGGAAACATTAATATATTGCGGACATGAGTATACCCTT AATAATATAAGGTAATCATATAAAAATGGAATATATAGAAATATGTCTTTATATTAATTTTTAATGAATATTAAAGTATT AACACACATATTTTTTTTTTACATGTATCTTTTATGTGGAAAAAATTAAAACAAATAATATAAAATATGAAACAATATAC CAGACATGTATAAAATATAAATATAGAAATATATATATTATATTTTTGTTCCAGATTTGCATTGAGCATTGAAAATGATA ATGAATATATGAAAAACAAATTGAATGAAGTTACAGAAAAGCTTAAAAACAAAGAACATTCTGTACCTTCAACAATTGAA GAAGAGAATTTAATCAATCCATGTGCAAAAAATATCACCAGATTATTATTTATATTTTAAGCAACGAAAAGACAAAATGG AAAAACACCCTCCTGGATATTTGAAGCGTGTGCGTTTGCATGGTCAGATATGGGGAAATTTTCATGCGGACAAAAGAAAT TGCAAGAGAAAATTTTAAACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAACTCGAGAAAAAAAAAACTCGTGACTAGTTATCTCGCTCTCATCTCTCATCATGAAATTCTATAAATCCTCCTCTTT TCGGGCCATATATTAAAAAATATATGCTTACATTATAAACAAAAAAAAAAATATTAAAAGAAATTTATAAAAAATAAAAA AATAAAAAAACAACAAAATAACAAAATTAATAAAAAAGCTTTAAAATATATATATATGTAAATACAAAATACGTGAACTA TACCTAAAATTTTATAAAATAACATAAATAGTTATATTTTGTAGAAGACAGTACCAAATAAAGAAATAGTATATATATAG TAGAACATGAATTAAATAACAACCATATATAGAAGACAATAAAATAAAAAAATAAAATAATAAAAAAAATACCCATATAT GGGATCTTACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGTATCTTCTCATTATATAACATTATAGTGTAAATTTAAAA GTTAACATAAAAATACCCTTCAGCAAAACAAAATAAATATATTAACATTTGGTGTGTATTTATATATACACATAATAAAG TCCTTCAAATCAAAGGATAACATATAATTTATCTAGTTATATATAATTTTTTTTTTTTTTTCTTTTTTTTGTTATAATAT CTATGTATATATATAATTTCCTTTATTCTTTTCATCTAATTTTTTTTTCGTCTATGTTTCATATTTTTTGGTTTTTAATT TGCATTTAAAATATTTAAACAAGAAAGAAATAGCCATTTCTTCATTATTTTTAAACATATACACATATATATATATATAT ATATATATATATATAGTGAATAAAAATATATGGTATTATTTGCCATAGTATTACATTACCTATTCCTTCAGTAGTTAATG CTCCTGCTCTTTTCGTGGGGTCAACATTTGCTTGTTTACATATAACAGTTGCCATTCTCTTTCCAATACCTTTAATAGCT GTTAAGGCAATAATTACTTTTTCTTTACCATCTACATTTGTATTTAAAATTCTTAATATATGTTGAAAATCATTATTATC TATTACTTGTAGTGACATTTTTAATAACACTTTTGAAAAATAAAATAAAATAAATAAGAACATAAATATGGTAAACATAA ATTGGCCAGGGCTTCTTAAGTGGTCTACGAAAATTTGGTATTGCAGAATTCAANATCAAGCTTATCGATACCGTCGACCT CGAGGTNCNAGGTATCNATAAGCTTNATNTTGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCACCG CGGTGGAGCTCNNGNT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_735: (20 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2838319175T026560026M3gmbPfHB3.1, G. Roman Reddy
2839319176T026570026M7gmbPfHB3.1, G. Roman Reddy
5043271674511N975390045C3czapPFDd2.1, Debopam Chakrabarti
5043281674512N975400049C3czapPFDd2.1, Debopam Chakrabarti
5043441674528N981460099C7czapPFDd2.1, Debopam Chakrabarti
5043451674529N981470100C7czapPFDd2.1, Debopam Chakrabarti
5043741674558N981920249C3czapPFDd2.1, Debopam Chakrabarti
5043821674566N982000274C3czapPFDd2.1, Debopam Chakrabarti
5044991674683N976650823C3czapPFDd2.1, Debopam Chakrabarti
5046331674817N977991281C3czapPFDd2.1, Debopam Chakrabarti
5046421674826N978081299C3czapPFDd2.1, Debopam Chakrabarti
5047661674950N979321561C3czapPFDd2.1, Debopam Chakrabarti
5047981674982N979481709C3czapPFDd2.1, Debopam Chakrabarti
5048651675049N980152042C3czapPFDd2.1, Debopam Chakrabarti
11998862320128AA5498760949m3gmbPfHB3.1, G. Roman Reddy
12000272320269AA5500171096m3gmbPfHB3.1, G. Roman Reddy
12002282320470AA5502181336m3gmbPfHB3.1, G. Roman Reddy
12003142320556AA5503041433m3gmbPfHB3.1, G. Roman Reddy
12003822320624AA5503721518m3gmbPfHB3.1, G. Roman Reddy
12006392320881AA5506291817m3gmbPfHB3.1, G. Roman Reddy


Date: 21:4:59 on Fri 24 Nov 117.