CPlasFal_740


Sequence

>CPlasFal_740 (4 EST) Length=1340 CTACTTTTTTGCTTTCATCTTTTTCGTCACCTGATACTTCTGGTTTTTTATTAGATTTACTAAGATAACCAAAACCTAAA GCACTACCTAAGAGTAAAGCAAGACCAGTAACAACAGTAGATATCATTATTATTTTTTTGTTGTTGTTTTTTCTTTTGCA TCTCGTCAATTTTACTCATGACTATGCTATCAACATTAACATTTTTCCCTAATACGTTCATAAATCCTGGAACGAAAACG TTCATGCTGATGAGGAGGGCAAAAACGTAAAATAAGTTGCTCAATTTCATTTTTTGCTTGGGTGAGAAAAAATAAAATAA AGGAAAAATATTAAGTTTTAAGAAAATATTAATATTTATTTTTAAAATAAATAATAATAAGAAAAAAAAAAAAAAAAAAA AAAAGACGGTTTATAAAAGTATAAAAAAAATTATATCATCTTTTCAAAACAACAAAATGTATGTATATATATATATATAT GTGTGTGTGTGTGTGTGTGTGCGCGTGTTTTTTTTTTTTTATATGTATATATTTTATCCTAGACAACTCTCACAACTATA TTCCATATATAAATATCCATCTTCATCTTTATACATTTCATACAAATCTTGCATTAACAATCCTGTTTTAGGAACTATAT TATTTACAAATAAATATATGGTACGTTCTCGAAATAATTTCATGTTACTTCCATATGCACTTTGATTAATATGTTGATGT AATATAAATTTAAATTCACCAACTAACATATTCATAGGTACAAGGAATTTCTTCTTTTCTATTATGGGTAAATTAGATCT GTTAGCTCTCTCACATACTACAGGTATACGATTAGGATATTTGGAACGAATTTTATGAGTCTCTGCAACTCTGTTTTCGA AAGATACTTCGTCTTTAAGCGATGGCATTATAAATAAAAATGTAAGTACAAATATATATATATATATATATAAATATATA TATATATATATAAAATATAATCAAAAATGTCAGGAAGAGGTAAGGGAGGTAAAGGTTTGGGAAAAGGAGGAGCTAAGAGA CACAGAAAAATTTTAAGAGATAACATTCAAGGTATTACAAAACCAGCCATCAGACGTTTAGCAAGAAGAGGTGGTGTTAA ACGTATTTCTGGTTTAATATATGAAGAAATCAGAGGAGTTTTAAAAGTTTTCTTAGAAAACGTAATTAAAGATTCCATCA TGTATACTGAACACGCTAAAAGAAAAACCGTCACTGCTATGGATATTGTATACTCCTTAAAAAGACAAGGAAGAACTTTA TATGGTTTTGGAGGTTAAACATAAACATTATACCAAATCTAGAAACTGTATTTATTTATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_740: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046391674823N978051288C3czapPFDd2.1, Debopam Chakrabarti
5048921675076N980422104C3czapPFDd2.1, Debopam Chakrabarti
12001582320400AA5501481261m3gmbPfHB3.1, G. Roman Reddy
12005092320751AA5504991654m3gmbPfHB3.1, G. Roman Reddy


Date: 12:51:3 on Sat 18 Nov 117.