CPlasFal_747


Sequence

>CPlasFal_747 (2 EST) Length=401 ATTCAAATTATTACCAGTTCATCAATAAATAACTCACTATTAATTGGAACTTCATNTTCTCTTTTTTCTAAATAGAAAAA AAAAAAATTAAAATATTATATTACATATATTTGTGTAAAAGTATGTATTAATAATTTAAACAATATGTAATTTTTTTTTT TTTTTTCAATATACACATACCATTAGGATTTTCGGTTTATTTCTCCGTTTACACAATTTTCCTTTTCTGGAGTATCTTCC TTATCGTCCTCATCATCATAAAACAAGTCATCGTATTCGTTCGTATTAGCCGCATTATCATCATCAACAAATAATCCTGA AAATATAGGAATATATATCGAATTCCTGCAGCCCGGGGGATCCNCTAGGTCTTAGGAGCGGGCCGCCACCGGGGGTGGAG C


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_747: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2938319274T027560096M3gmbPfHB3.1, G. Roman Reddy
2939319275T027570096M7gmbPfHB3.1, G. Roman Reddy


Date: 2:17:53 on Thu 23 Nov 117.