CPlasFal_755


Sequence

>CPlasFal_755 (3 EST) Length=710 AACCTGGGNCAAGNGGTTCCTGAAATGTAATACTGANACCATTAGATAAGGGAGGTTATAAAAGNACAAAAGGGATNANT TATACAATANCTATAATATATTTTTACATGATGAAAATAATGACTATAATGAAAATGAAGNAGAAAACTATAAAAGGNAA TTAGGAAAATTAAATTTACTTCTTAATGAAAGAAATATGNAAATATTAAAAATAAGTTGTTTTTTATTAAGATATATATC TATAGATAATAGACAAAGTAAAATGGTAGATGATATTTTTATGTTTTTTTTTTTAATGAAATTAAATTTTGTTATGAATA TGAAGAAAGATATACAAAGGAAACATATCGAAAAAGATTTTAATTTCAATTTTTATTTTTATATTTTATTAATTATATTA TTTTTGCTGTTTAGAAATTAGATAAGGAGAAGAAAAAAAATGTAATAGAATTAAAGGAATATTTAGAAGATTTGAAAAAA AGAATGTTTGATATGCAAAAAAGATTGAACGATATAATTATTACTAAGTCTACTTTTTTAAAAAACGAAAGTGAATTAAA TATGAAATTGTTTGAAACAAGTGCTATAGATTATGTTAATAATAATAGTAATTTTGAAGTTTTTTCAACATACATAATAA ATGATTTTATGTTAAACAAGAAGAGAATAAATGTTTTAAATTATGACAGCAATTTATTTTTTAAGAATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_755: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28709319445T096130200m3gmbPfHB3.1, G. Roman Reddy
28710319446T096140200m7gmbPfHB3.1, G. Roman Reddy
29037319773T099410490m7gmbPfHB3.1, G. Roman Reddy


Date: 18:56:59 on Thu 23 Nov 117.