CPlasFal_756


Sequence

>CPlasFal_756 (2 EST) Length=400 AAAAACTTTAAGTGAAGTATCAATTCAAACAGAAGATAATTATGCCAATTTAGAAAAATTTAGAGTATTAAGTAAAATAG ATGGAAAACTCAATGATAATTTACATTTAGGAAAGAAAAAATTATCTTTCTTATCAAGTGGATTACATCATTTAATTACT GAATTAAAAGAAGTAATAAAAAATAAAAATTATACAGGTAATTCTCCAAGTGAAAATAATAAGAAAGTTAACGAAGCTTT AAAATCTTACGAAAATTTTCTCCCAGAAGCAAAAGTTACAACAGTTGTAACTCCACCTCAACCAGATGTAACTCCATCTC CATTATCTGTAAGGGTAAGTGGTAGTTCAGGATCCACAAAAGAAGAAACACAAATACCAACTTCAGGCTCTTTATTAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_756: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044391674623N976051039C3czapPFDd2.1, Debopam Chakrabarti
5045391674723N976891114C3czapPFDd2.1, Debopam Chakrabarti


Date: 22:12:29 on Sat 18 Nov 117.