CPlasFal_764


Sequence

>CPlasFal_764 (4 EST) Length=504 GGCACGAGGCAAAAATGAAGAAAGATAGAGAACCAATAGACGAAGATGAAATGAGAATAACCTCAACCGGAAGGATGACC AACTATGTTAACTATGGTGCAAAAATACTAGGAGATGAAGACAAAAAAAGTATAAAAATTAAAGCAACAGGTAATGCTAT TGGAAAAGCTGTAACATTAGCAGAAATAATAAAAAGAAGATTTAAAGGATTACATCAAATAACCAGATGTGGAAGTACAG TTATCACTGATCAATATGTAAGTGGNCAAGNTAATAGCGAACATGTAGTNCAAGNNAAAACCCGTTTCNATTTATTTGAA ANTATTATTATCTTAGNGGACCANTTTAGGNTATTGGAAAGATGCAGGTTATCAACCACCTTTGGATGAGAAATATGTAA AAGAAATGACCCCAGAAGAAATTGTCAATTCTAGGCCATTCAGAAGAGGTGGATTTAGACCACGATTTTATAGAGGATTT AGAGGAGGAGGAGGTGGATTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_764: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2717271390T025360149C3cbsPfHB3.1, Debopam Chakrabarti
2751271424T025700206C3cbsPfHB3.1, Debopam Chakrabarti
5047171674901N978831444C3czapPFDd2.1, Debopam Chakrabarti
7963521710353U78748PFU78748Plasmodium falciparum NF54 (D.A.Fidock)


Date: 3:50:39 on Sat 18 Nov 117.