CPlasFal_767


Sequence

>CPlasFal_767 (2 EST) Length=534 TATCATTATTATTATNTAATATGTGTTGATTCCTGTTTTGAAAAAAGAAAATTTGCATATATNATTATAGGTATTTGTAT AACAAATAAAAGCATAAATAATATAGTTAACCTACCAGCAAATAAATATGTTGATGGTATCCCTAATTTTATTAATAATA TAATACATATTAATAATACAATATAACATATACTTTGAATAATACCATCAGCATCCATATATATTTAAAAACAAATTTGT ATTTAATTTATTCCCATTAATACCGGTCATATCATTTGTGTCATTAGCTAAATTAGAAGTTGTTATATTTTTTCGATATC TGTGTAATAANTCTTTACCTATTTAATGAGTAAATAATTAATATAGGCTAGCACATTTTTAAGGAACCTATAACTTATAA AATGACCCATATATTTCCTTAGTAGTTCTCTATACTTCATAAATTTTAGTGTCTCACCAAATCCATAAACATTGTTATAA TAATTATAATAATAACTATTATGATTATTCACATTATTGTTATGATTATTCACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_767: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28862319598T097660359m3gmbPfHB3.1, G. Roman Reddy
28863319599T097670359m7gmbPfHB3.1, G. Roman Reddy


Date: 10:52:1 on Tue 21 Nov 117.