CPlasFal_773


Sequence

>CPlasFal_773 (2 EST) Length=502 ACCATATTAAAATGGTTTTCCGAATCGGATAATTCTGATGTTTCTAATGTAGCAAAAGAAGTGAAAGAATCTCAGAGAAA ATGTTTNCGAAATTATTTCTTTTTCTTTAGAAATGTGAGGAATTCAAAATATTTAGCTCACAGATATGACTTTTCCGAAA ATGTCGATGCTATAAGTATACCCGGATTAGATCCCAATGGATATTATTATTATGAATATATGAGAGCTTCCTTATTAAAA TATAATGTGAAATTAATTAAAATACCAAACGCTGTAATTCTATTTTTAATTTTTGTATGTATTTCTTTGAGACCATTTTA TAATATAAGATTAAAGGCGGAAGTTATATTTTTAAATGTATTATCACTTATATGTATAATAGGAATAATATCTCTTTTTG TTTATTTGTACCGAATTGATACGAAGTTGTTACCTAGAGACATATCAAAATATTTATTAAATAAATATCATATTGAGACA TGTGATAAGAATAAAAGAGACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_773: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044611674645N976271071C3czapPFDd2.1, Debopam Chakrabarti
5046981674882N978641409C3czapPFDd2.1, Debopam Chakrabarti


Date: 14:3:27 on Fri 17 Nov 117.