CPlasFal_785


Sequence

>CPlasFal_785 (3 EST) Length=490 AAAAAGAACAAGGTGATAAAAGTAATATTATAGAAAGAAAAAATTCCAAAGATTCGAAAAGTAAAAGAGATACACTACAC TCATTACATAATCAAAGTGAATTAAGTAAAAGAAGTAGTGTTAGACGTAGTGAAGATAGAATCCGAGTAAGATATCGTAA ATCATTAAGGCCAACATCTGAACAATTACAATCATTAAATTTAAAAGAAGGTGCTAATACAATTACATTTCTAGTTACAT CTTCTTTACAAGGTACAAAAAGTATCACAGGAAATATATACTTATGGAAAAAAAATGCGAAAATTGTTATATCAGATGTA GATGGTACTATAACTCGNTCAACAGTATTAGGACATATTATGCCTATTGTAGGTAAAGATTGGTCACATGTAGGTGTTTC TCAACTTATTCAACAAAATTAATAAAAATGGATATCATATCTTATATCTAACAGCTAGAGCTATTGGACAAGCAGATTCA ACTAGAGAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_785: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045341674718N981611104C3czapPFDd2.1, Debopam Chakrabarti
5045411674725N976911116C3czapPFDd2.1, Debopam Chakrabarti
5047251674909N978911462C3czapPFDd2.1, Debopam Chakrabarti


Date: 2:44:52 on Sat 25 Nov 117.