CPlasFal_791


Sequence

>CPlasFal_791 (2 EST) Length=486 CTCCTTTTATTTGTTCTTAATTCATCTTATAATTCACTTTATAATTTGTTTATTATTCATTTTATAATTTGTTCATAATT CATTTTATAATTTGGCCATAAATTTTACATTTATGGCATAATCCGCCCTTTATAAATGGTGTACCATAAAACTGTCCATT ATCAAACCTATTCACATTCGTTATATATTTATATATAAATCAAATAATTAAAGAAGATTTAGTAAATATTAAAATAAAAA AGAAACTATCCGTTTTGTTATTTTTTCATATTTCCTACAAATTATAAATTAGACAAGGTTCATTTTATATCATCTATTAT GAATATACATAAGGGTAACAAATAAACAAAACATATATTTTGATTATTTTATGCATTGGTAAATGGTGATTATAAAATGG GGCACGTTCACTAAATTTTTTTCTGTATTCAAANAAAATCAAAAAAAATAAAATTAACAAATATATATGTGTCTAATATA AATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_791: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28897319633T098010383m3gmbPfHB3.1, G. Roman Reddy
28898319634T098020383m7gmbPfHB3.1, G. Roman Reddy


Date: 13:25:44 on Fri 24 Nov 117.