CPlasFal_799


Sequence

>CPlasFal_799 (4 EST) Length=968 AAAAAATATGGATAGATTAAATTAAAAACTAAAATGTTATATATACATATATATATTTTTTATATTTATAATTTATTCCA TATAGGTGTCTTGTTTTGTAAAAATGACATAAAATGTACAACAGTGGACGAGAGTACCAAGGAAGGTTCTCAAAATCCTA AAAATTCATCCTCTACTACACCTGCATCTGGATCTCAAAAGGGTAGTTCTTCTGAATCACCAGGTTCAAGCGTAGAGAAA CAATCACAAGAATCCAATAAAGAAAGTACCAATGGTGGTAATGTTGTAAGCCAAGGTACTCCTGCTAATACTTTTGGTCA AAATTCTAATTAATCCTTCCGACTCACCCCAAGGTACTAGCACTCTTTCCCAAGCCCTCCTAAATCAATTGATGGTAAAA TCTGCTTTCTTAAAACATTACAAAGGAGTAAAGGTTACTGGTCCATGTAATGCAAATTGTCAATTATGCCTTGTCCCACA TATATTCATAAACGTTGAAACAAAAGAAAATAACATTCCAGTTGGATGTAAAATTTTTGAAATTAACTAAAAGAATAGAT TTTGCAAAAGATAAAAGTATGTTAAAAGAATAAATGTGAATCTGGAAAAAACCAAACATTTAAATTTGTATTATATTTTA AAGATGATATACTAACAATAAAATGGAAAGTATACGAAGAGAAATCTGCTACTCCACGNNNCGAATAAAAAATAAATATT ATGTGTATAATATTATATGGAGATATTCTCATACATATTCNANTATTATATATATATATATATATATGTATGTATGCATA TGCTTTCTTTTTAATTTATGTTTGTTACCCTTTCTGGTAACTCAAGTACATGCATTGAAGTATCATAATTCACTCCATTA CTTATGTTTCCATTAATATATATATTATTCATATCAGAACTGATATCATTTAATTGGTTTATATTATTTTGTTTCCACTT TTCTTCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CPlasFal_799: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28916319652T098200404m3gmbPfHB3.1, G. Roman Reddy
28917319653T098210404m7gmbPfHB3.1, G. Roman Reddy
11999102320152AA5499000973m3gmbPfHB3.1, G. Roman Reddy
12000962320338AA5500861184m3gmbPfHB3.1, G. Roman Reddy


Date: 13:38:39 on Thu 23 Nov 117.