CPlasFal_802


Sequence

>CPlasFal_802 (4 EST) Length=469 ATTTCTTCTTTCTACTTCATCATTTGGATCGGTATTAGTCAATATTTTATAAAATACTTCTAAGTGTTTACGATATTCTG GATCAGCAGCATATTCTCTCATTATTTGACCTTCTGGATCGGCACTAGTTAAATCTTCTTTATTATCGGCATTTCTTCTT TCTACTTCATCATTTGGATCGGTGTTAGTTAATATTTTATAAAATATTTCTAAGTGTTTACGATATTCTGGATCAGCGGC ATATTCTCTCATTATTTGACCTTCTGGATCGGCACTAGTTAAGTCTTCTTTATTATCGGCATTTCTTCTTTCTACTTCAT CATTTGGATCGGTGTTAGTTAATATTTTATAAAATATTTCTAAGTGTTTACGATACTCTGGATCAGCGGCATATTCTCTC ATTATTTGACCTTCTGGATCGGCAGCTGGTTAAATCTCGTGCCTTATCTCTCTCTCTCTCTCTCTCTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_802: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2787271460T026060252C3cbsPfHB3.1, Debopam Chakrabarti
5045861674770N977521197C3czapPFDd2.1, Debopam Chakrabarti
5048311675015N979811747C3czapPFDd2.1, Debopam Chakrabarti
5048571675041N980072030C3czapPFDd2.1, Debopam Chakrabarti


Date: 11:57:6 on Fri 24 Nov 117.