CPlasFal_807


Sequence

>CPlasFal_807 (2 EST) Length=529 CATTCATAATATATATTATATAAATAGTTGAACCCTATAAGGATAAATAAATTGTAGAAACTGTATTCATATTTATTTCC TTTTAGGGAAAATCAAAGAAAAAAGAAAAAAAAAAAAAAAAAAAATGACGAACAAATTCAACAAAATAAATAAGAACAAT TACGAAACACGAGAAGCAGTTTATTACGATAAGGGAAATAGAATTAATTCGAACAAAGAAAAAGAAATGAAAGAGTTTAA GGAAGAAGAACTAAAAGAATTTTTTAATAAATGGAATCCGTTTTATAAAGAGAAATTGAATAGTGAGATAGAAAAGAAAA ACTTTATAAATTTTGATGGAGAAAAAAAAATGGAAAATGGAAATAATGAATATTTTAATTCATACAATTATATACATATA CATGAAGATATGATAAAAGATGAAGTAAGAACACGAACATATTATGATTCTATAAGAAAAAATGAACATTTAATAAAAGA TAAAATAGTTTTGGTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_807: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046451674829N978111305C3czapPFDd2.1, Debopam Chakrabarti
12003542320596AA5503441485m3gmbPfHB3.1, G. Roman Reddy


Date: 2:34:56 on Mon 20 Nov 117.