CPlasFal_836


Sequence

>CPlasFal_836 (5 EST) Length=1020 TNTANCCNATACNAGAATATGAGGTGAAAGAAGGGNTACTTTCCGAAGCTTTTTAGGAAATTTTGAAATGGTAANNAAAN TGATATAAATGCTGAANCTTTTAAAACACCAACNTCNTTTTTTGTNTCNCATCACTTACCTATGACAGTATGGTCATATA GTGACCATTCAAATAATGATGAATTAAAGGATATGAATGAAACTAATAGTAATGCTGATATTAAAGATGATGNAAAAAAA GTGACTGATGAAAATGATGCCATAGATNCTCAAAATAAAAATGAACACAACGACTAATTGCCTACNGCGACTATCTTTAT CTTTAAGAATTTTATATATTACAAAAGTGTTCTTGTTATACACACACATATATATATATATATATATATATATGTTTTNN CAAATATGTATTTTAATATAAATGTACATAAATGTTATATATATAAAGGATTCAAAAAAATTACATATGTATATTTAATA TGCATAAATATATATAGGTATTTTTTTCTTAATTTATAAAAATATTTCAAATTTATTAAATTAGNCGNCTATAATTAAAA AAATATATATAAGTATAAAATTATACATATAAAAATAAANAAACTTAAAAAAAAAAAAAAAAAAAAAACGGTATCTNCGA AGTAGTATAATGAAAATATGAATAATAATACTTATTATTATTATANGAAAACTAAAAATACGAATNAAGAAGACTAGCTT TCTTGAATCAAAATATNGATAAAGTTGTAAACAATGTATTAGGGTTATTTAAAAAAAATTACAAAAACCAAATTTCTTTC AACATCTTCAGCCTTATGTAATGATGTACATGGACAAATATTAAGCTCAAGATTATTTCTGGATTTGTGTGAGGANAAGG NAATATTATTATACAAGATATTAAAAAAATTGAATATATTAAATTTGATTTATTTTCGTTTTTTAAAAGAAGAAGATATC GAAGATGTTCATGATTTACATAAAGAATTATTCCCTGTAAAATATCATTCGGATTTTTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CPlasFal_836: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2930319266T027480089M7gmbPfHB3.1, G. Roman Reddy
28609319345T095130107m3gmbPfHB3.1, G. Roman Reddy
28610319346T095140107m7gmbPfHB3.1, G. Roman Reddy
5044981674682N976640817C3czapPFDd2.1, Debopam Chakrabarti
5047651674949N979311560C3czapPFDd2.1, Debopam Chakrabarti


Date: 5:58:28 on Sun 19 Nov 117.