CPlasFal_837


Sequence

>CPlasFal_837 (2 EST) Length=660 GACAAAATTCTTATATTAGAGGTACCAATGGAATATCTAATGGTTTAGTACCTATGTTAAGAGTTTTTAATGATACTGCA AGATATGTAGATCAAGGTGGAGGAAAACGTAAGGGATCGTTTGCTGTTTATATTGAACCATGGCATTCAGATATATTTGA ATTTTTAGATTTAAGAAAGAATCATGGAAAAGAAGAATTAAGAGCACGAGATTTATTTTATGCTGTATGGGTTCCTGATC TTTTTATGAAGAGAGTTAAAGAAAATAAAAATTGGACATTAATGTGTCCAAATGAATGTCCAGGTTTAAGTGAAACCTGG GGTGAAGAATTTGAAAAATTATATACTAAATATGAAGAAGAAAATATGGGAAAAAAAACTGTTCTTGCTCAAGATTTATG GTTTGCTATATTACAAAGCCAAATAGAAACAGGAGTACCATATATGCTATATAAAGATTCTTGTAATGCAAAATCCAATC AAAAAAATTTAGGTACTATTAAATGTAGTAACTTATGTTGTGAAATTATCGAATATACCTCTCCTGATGAAGTTGCTGTA TGTAATTTGGCATCTATAGCTTTATGTAAATTTTGTATGATTTGGNAAAAAAAGTATTCANTTTCAAAAAGTTATATGAA ATAACCAAAATTATTACAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_837: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44061462808T180220367c3cbsPfHB3.1, Debopam Chakrabarti
5045441674728N976941121C3czapPFDd2.1, Debopam Chakrabarti


Date: 11:33:2 on Wed 22 Nov 117.