CPlasFal_850


Sequence

>CPlasFal_850 (2 EST) Length=493 TTTAAAAAATTCGGATCTTTCGTTGTCTGGTTCACTGAATTCTGGAATTTATATAACATCATATCTATATTTATGTTTTG ATATATTGGTCTCATTCTTCCATTNACAAAAGTTCGGGTCTGCGTATGGGAACATTTGATTTTGTGACTCAGGGAATATG GGTACATTTGGATAGTACTCTGGATCAGTTGCGTTGTTATGTTTTGTCTTTTCTGCTATATGGGATATATTTTTTTGACT ATCAATATATGNCTGATTCATTCCTGAATGGTCTTTAATTGTTCTTATGTTAGCATCTTTTTTATTTAAATTCATTTTAC TAAGAAAGGTATACAATAATATAGTTGTGTATACATAATATATATATATATGTATATAATGAAGTAGATAATTAAAAAGT GAATGCTTTTTATTTTATTCTTCATTAAAAAAAAAAAAAAAATATATAGACTCAAAATAAATTTCTCTTATAATATTTTA ATATTTTCATTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_850: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5043981674582N975480398C3czapPFDd2.1, Debopam Chakrabarti
5044411674625N976071042C3czapPFDd2.1, Debopam Chakrabarti


Date: 9:30:33 on Thu 23 Nov 117.