CPlasFal_860


Sequence

>CPlasFal_860 (7 EST) Length=1415 GATGATCTCTTCATGCAGGGAAATGGTGATAATCACCTGTCCAAGGATATTAATTGTATAAATGGGAATGAGGATATTGG TTTAAATGCGAGCTGTGAACAAAACGAAGAGAATGAAAATCATGAAAAGAGTGATATGTATAATTACAAGAATGATAACA GTATCACAAATATGGAGAAGGCCCCAGAATAATATCACGCTTGTCCATAAAAATATAAAGGATGAAGACAATTTCGAAAC AATATTTTTAAAAACACGTAGTTCTTTTAGTAGTGTAAATAGTAATATTATTCATATTGATAATACACAAAATTTTAAAC TTTCCAATTCTTCAGNAAATAAATTAAACCAATTTGAAAAAAAAACTGTATTATTATCCAATGATATTTTATATGACGCC AAAAAAGAAATCGAACAAAGTTACATGAACAGTCAGGAAAAAGGAAAAAATTACCTGCACTAGCAAGGAAATAATTGNTA ATATATATATATATNTATATATATAGTAAAGTATAAAGGAAATACTTACATTTTTATTTATAATGCCATCGCTTAAAGAC GAAGTATCTTTCGAAAACAGAGTTGCAGAGACTCATAAAATTCGTTCCAAATATCCTAATCGTATACCTGTAGTATGTGA GAGAGCTAACAGATTTAATTTACCCATAATAGAAAAGAAGAAATTCCTTGTACCTATGAATATGTTAGTTGGTGAATTTA AATTTATATTACATCAACATATTAATCAAAGTGCATATGGAAGTAACATGAAATTATTTCGAGAACGTACCATATATTTA TTTGTAAATAATATAGTTCCTAAAACAGGATTGTTAATGCAAGATTTGTATGAAATGTATAAAGATGAAGATGGATATTT ATATATGGAATATAGTTGTGAGAGTTGTTTAGGATAAAATATATACATATAAAAAAAAAAAAACACGCGCACACACACAC ACACACACACATATATATATATATATACATACATTTTGTTGTTTTGAAAAGATGATATAATTTTTTTTATACTTTTATAA ACCGCTATTTTTTTTTTTTTTTTTTTTCTTTTTTNATTATTANATANATANGATTATGAAAAATAAGTGCAATATAATTC ACTACAATCCTTCATTTCCATTTTGTATATCAGGTATGTCCCTTTTATCCAATATGGTAACTAAACTTTCTCTTGTTAAC ATTTCTTCCTTCAGTGTCCTTTTTTGGTGTAAGCATTTTCCATTGTATATTAACATTTGATTTTCTTCTTCAATTTTTAA GACTCTCTCCACTTGTTTATGTAACATATCTATCGAATCCATATGATTTAATGCAATGCTCTAAGAAGGAGACAAATGTA TCAAAAAAGAGTGTAGAAGAAAATATATACATAAAAATACATACATATAAGTTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_860: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2852319189T026700035M3gmbPfHB3.1, G. Roman Reddy
2853319190T026710035M7gmbPfHB3.1, G. Roman Reddy
28914319650T098180403m3gmbPfHB3.1, G. Roman Reddy
28924319660T098280408m3gmbPfHB3.1, G. Roman Reddy
28925319661T098290408m7gmbPfHB3.1, G. Roman Reddy
44175462922T181360698c3czapPFDd2.1, Debopam Chakrabarti
12005302320772AA5505201678m3gmbPfHB3.1, G. Roman Reddy


Date: 11:55:31 on Mon 20 Nov 117.