CPlasFal_865


Sequence

>CPlasFal_865 (2 EST) Length=607 ATTATCAGAATACCAGGGCACATAAATTTTACAGNAGNANAAGAGTTTCCAATATAACCAACGATATGATTNAAAAAGAT TTCACTCAAACTAATGCACTTACCAATTTACCAAACTTAGATAATAAAAAAACCACTGAATATTATTTAAAAGAATATGN AAATTTTGTAGAGAACTTCCAACCAGATCTTCATGATATCATGAAATTGCAACTCTTTTTCACTATGGCCTTTAAGGACT GCGAGNGCGNCCAAAGTAACACAAGGAAAAGAAATTAAAAATGTGTACATAAATAAATTAAANNAAAAATATATATATAT ATATATATATATTTTTGTGTTTCTCCATTTTNAATTTTTTTTTTNAGGATGATGATAACANGTGATTTTTTCCNTCACGG NTTTGATGGTAGTGGAGGTGATAATTTNAATGAGGCAGGAAGTTGCATTGATGGTCGACTAACATCAGCTTGGAATTGGT GTTCAAAAATTGAGAAGAAAAAATACTTTCCCATATTTTAATTAACTGGTTTTGTGGGATTTNATGGAACATTTNAGGGG GNATATTATATNATGTATAAAANGGGNAAAACAATTATTATACNNCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_865: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2962319296T027800126M7gmbPfHB3.1, G. Roman Reddy
2970319304T027880131M7gmbPfHB3.1, G. Roman Reddy


Date: 14:41:34 on Sun 19 Nov 117.