CPlasFal_88


Sequence

>CPlasFal_88 (2 EST) Length=742 TTAAAATAAATAAGTAATAATGTTACATGTTTATTTTAAAATATTCTATATAGCAGTTCTATTTGGATTAATCTTTTTGA ATCAAAATGTAAGAGAAACAAATATATTATATTAAACACAAAGAACAAAAACCAAAAGATAAAGAGATTAAATAATTCTA AATTTTACATTTTTTATCATATATTCTTATTTATGTGTGTTCATTTTGTTGAAATATATCAATCAATTTATTATATAACA AAAATAAAAATATTCATATATGCACATGTATTAATGCATGTTAATAATACATATATATATCTTCCTTAATAGGTGTGCAC ACAAAAAGGACCATATGAAGTGAAAAATGAACATAAAAACTTAAAAACAAGAACATTAAATTACTTAAGAGAAAACAAAG TAGACGAACCAAATAAAATGGAAGAACACAATAAAATGGAAGAACACAATAAAATGGAAGAACACAATAAAATGGAAGAA CACAATAAAATGGAAGAACACAATAAAATGGAAGAACACAATAAAATGGAAGAACACAATAAAATAAAAGAACATAATAA AATAAAAGAACATAATAAAATAGAAGAATCAAATCAAACAAAATCACCATTAAGGAATCATCAGATTCAAATAAATAATA CTATTGATAAAATAATTCAAAATTCCAATGGAGATGAAAAACTTCAAAGACTTAAGAGTACATCCTGGNTAATAAATAAT ATGGAATCANCTGAAGAAGTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_88: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5047531674937N979191537C3czapPFDd2.1, Debopam Chakrabarti
12003462320588AA5503361477m3gmbPfHB3.1, G. Roman Reddy


Date: 4:15:47 on Thu 23 Nov 117.