CPlasFal_880


Sequence

>CPlasFal_880 (2 EST) Length=698 AGAGANATATATATATTAAATAATTAAAAAAATTTGGAATTTTAAAATTTGTGGGCAACAACAACACCACCTGGGTTTAT ATTTCCTCCATATTTACTATCATCTGATTGAACCTTTAAGAGAATATAGACACATAGATTATAATATGATATATTGATAA TTATGAATTTTATTTTATTTATTGNTTATTTATTTTTTTTTGCATATTACTGATCCTCTTAATCCACACTTTTTACTTTT TAAACATGACTGATGGGGTTGTTCTCTTTTAATAAAATCAAAAACTACATAGCCTTCTCTATTAATAAAATAATCTATGC TCTCACAAAAATAGCCTTCTATATTATCTGAGGAAATNNNTAAATATATATATTTATATATTGTATATATATAATGCTTG TATTTATGTGTATATAAAATTTTCATNCTTCACATATTTCAACATGTTATACATTTTATTCCCACCACCTTCTTTATCCC CATGCTGTCAATTTTCCGCTCCTTTTGTTCTTTTTAGGTTTCTACCGAAGTAAATAGATCAATAAAACTTTTTGAAAAAT TTGAGAGAGAACACAAAAAAGATGGTACCGTAAGAATTTCTGAGGGTACTAATCAAACGACTTTTAGTTATGATATGAAG GGACAAAACAAGNAANAGGAAAAACATAATGNTAGGAAACATGNAAAAAGGGNATAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_880: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28837319573T097410339m7gmbPfHB3.1, G. Roman Reddy
29051319787T099550504m3gmbPfHB3.1, G. Roman Reddy


Date: 3:55:29 on Sun 19 Nov 117.