CPlasFal_884


Sequence

>CPlasFal_884 (2 EST) Length=388 AAGAAAAACATATCAACAAAAATATATTATAATATTTGCTTAATTTTTTTAATATAATATATTATTTTTATTATATCTTC CCTTCATTAAAGAAATTATAATATTTTAAAAAACTAATATTATAAGTATATAATTTTATTATTATTATTTTAAAGTGCTA ACCCAAAAAAAATTTAATTACTAAGTTTTTTATTTTTTTATTTTTTTATTTTATTATTTTTTAATTTTTTCTTTTTACAA AATGGCTAGAAAATATTTTGTCGCAGCAAACTGGAAATGTAATGGAACTTTAGAAAGTATTAAATCTTTAACAAACAGTT TTAACAATTTGGATTTTGATCCAAGCAAATTAGACGTTGTTGTTTTTCCTGTTTCCGTACATTATGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_884: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048001674984N979501711C3czapPFDd2.1, Debopam Chakrabarti
5048191675003N979691731C3czapPFDd2.1, Debopam Chakrabarti


Date: 15:59:26 on Tue 21 Nov 117.