CPlasFal_899


Sequence

>CPlasFal_899 (3 EST) Length=727 ATAANCTTGATGTATGTGGTTTTANAAAAATGTATATTGAGAAGGTTAAATTTGAACTCTGAAAATGAGAAGATCACGAG CTTAGATTCCCAGGCTCATGGCGATATGAATAGATTAGCTATTTCTAGCTTACACCAAATAAAAATATATCATATTCCTT TAAAGGATAAATGTTTAAGGAATAATAAAATAAACATTGAATTGTTATTTGTAAGTAATGATCATAAACTTGTTTATATT AATACGATACGTTGGAGTTTCAATGGTCTCTTTTTTGGCTAGCTGCGATAGTGGGAGGTACATTAGTATGTTATGAGGTT GGGATTTGAATAAAAAAAAAATTTATGGANTGAAATAAAAAAAAATAATGAAATATAACGAAAATAATGTTACATCATAA ATTTTGTAATTCATATTATTTCTTTAAGAATATATAAAATATTAAAAGTTCCATTTTTTTTTTTTTTTTTTTTCTTATTC GAATGGTTAATATTTTTAATTTTAACAAAAAAAATAAAGAACGAAATTATTAAAGTAAATAAACATATATTTTTTTCTTT TAATGTGATATATACAAAATGCCACGTATAAGAACTATGAATTCAAGAAAGCCACCTGAAGGTTGGCATAAGGTTGAGTC CTTTTTAGAAGAAATGAATAAAAAAAATGAGAAGTTTAGAAAATGAAGATACTTCTAAAAAAAGGAAAAATGAAATATTA TGGCCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_899: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29050319786T099540503m3gmbPfHB3.1, G. Roman Reddy
5042351400096N973870503M7gmbPfHB3.1, G. Roman Reddy
5049771675161N981112201C3czapPFDd2.1, Debopam Chakrabarti


Date: 15:17:48 on Fri 24 Nov 117.