CPlasFal_905


Sequence

>CPlasFal_905 (6 EST) Length=884 GAATGGAGAATTAGAAACAGCATTGATGGATTCACCGGTGATATAGTAAATATCCTTTTGGTTTTCCTTCATTCTGTCTA CGTATTCTTTTAATCCGATCATTTCGTCTCCTGATTTTGAGGTTTGGAATCGGAGTAATTCGGTGATCTTTGTACGATTT GCGTTATCCTCGTGGATACCCAACTTTAAGTTTTTGCTGAATTGTTCATAAAACTTTTTGTAGTTTTCCTTATTTTCAGC TAATTCTGAGAACATGTCTAAACATTTTTTGATAAGGTTTTTTTTGATAACCTTAAGTATTTTATTTTGTTGTAATGATT CTCTTGAAATATTAAGTGGTAAATCTTCTGAATCGACAACACCCTTAACAAAATTTAACCATTCTGGAATAATTTCTTCA CAATCATCCATAATAAAAACTCTNCTTACATATAATTTGATATTATTTCTTTTTTTTCTATTTTCGAACATATCAAAAGG TGCTCTTTTTGGTATAAATAATAAGGCTTTAAATTCTAATTGTCCTTCAACAGAGAAATGTTTAACAGCTAAATGGTCTT CCCAATCATTTGTTAATGATTTATAGAAGCTTGCATATTCTTCATTTGTAACTTCTTCTGGTTTTCTCATCCATAATGGT TTTTGTTTATTTAATTCTTCCCATTCATGTTCAACTGTGTGTAATTTTTTTTTTCTTTTTTACTTTTTTTTTCTTTTCAG CATTTTCTAATTCTTCGGTAACATCTTCAACTTTTGGATGATCAGTTTTGTTATCANCTTCTNCGTTANCTTCTTTTTTT TCTTCATCTTCATTTTCTTCTTTACTTTCATCAGCATTTTTATCTTCGCCTGTTTTTTTTTTTTTTTCTTCTTCTTCTTC TCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_905: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2663267601T024830072C3cbsPfHB3.1, Debopam Chakrabarti
44182462929T181430709c3czapPFDd2.1, Debopam Chakrabarti
44211462958T181720774c3czapPFDd2.1, Debopam Chakrabarti
5047891674973N977151700C3czapPFDd2.1, Debopam Chakrabarti
5048041674988N979541715C3czapPFDd2.1, Debopam Chakrabarti
5048251675009N979751738C3czapPFDd2.1, Debopam Chakrabarti


Date: 17:49:6 on Fri 17 Nov 117.