CPlasFal_907


Sequence

>CPlasFal_907 (2 EST) Length=469 TTTATTTATTTATTTATATATTTATTTATTTATATTTATAATTTTTTTTTTTCTTAGGATCTTGGTTTATCAAATTTTAT GCCCCCTGGTGCTCACACTGTAAAGCAAATGAGCAAAACATGGGCACAACTAGCCACTGAATTAAAAGGAAAAATAAATG TAGCTAAAATTGATGTGACCTTAAATTCTAAAACAAGAAAAAGATTTAAAATAGAAGGTTTCCCAACACTTTTATATTTT AAAAATGGAAAGATGTATGATTATAAAAATCACGATAGGTCCTTAGAAGCTTTTAAAAATTTCGTCTTAGAAACATACAA AAATGCCAAAGCATCTGAACCACCTAAACCACTTAACCTATATGGGTATTCTTAAAGGTTTTTTGAATGGAAACTTTTTC AAAATNATAGGTTAGGAATTTNTAAAATTCGGNTTTCCCCATCCTTAGGCTNGTTCCTTTGGTATCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_907: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28665319401T095690167m7gmbPfHB3.1, G. Roman Reddy
44054462801T180150341c3cbsPfHB3.1, Debopam Chakrabarti


Date: 11:43:1 on Fri 24 Nov 117.