CPlasFal_92


Sequence

>CPlasFal_92 (2 EST) Length=691 ATATTTATCATATGATTTTAATTCTTACTATTTGGAATAATACCACTAACATGGTCGTTAAATTCTTTCGCACTTGTCCT TTCTAAATTTTTTGTTTTTTTTGACATTTTTTCCATTTTTTCCACTTTTTCCATTTTTGCCATTTTTTCCATTTTTCCCA CCTTTTCCATTTTTTTTTTTTTTTTAATACTATCAAACAAATCTTTGGAACCTTTAACACTCACGTCTTCATTATTCATG TACATACAACCAATGTCATATATTCCATCGTTTTTTTTTTTATTTAATCTATTTAATAATAATGGTTTCGGTCAAAAAAC GGTGTTTTCATAATTCATCTAGGTGGCCTTTTTTGAAGGAAGATGTAGTACCATAAAACCTAGACATCCTTTTACTCCCA AGAGAAAAAAATGAATTTTTCGAACTTTTTTTTCTCATATTTTCTGAAAAAGAATATTTTATTTGACTATTTTCTCCTGC ATTTTTTTCTTCCATTTTTGTTATATTGCTTTTATTTTTACATTTGAATTTTTTTTTTTTTTTTTTTCCTTTTCCTTTTT CTTTTGGATTTTTTTTTGTTTTGGTTTGATTAACTTTACTGCTTTGAGATTCAACATCATCATTTTTTTTTTTTTTTTTT TTTTGCCTCCAATTATAAGTTACATCCATATTATCATTACTATTAATATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_92: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28754319490T096580232m3gmbPfHB3.1, G. Roman Reddy
12003342320576AA5503241465m3gmbPfHB3.1, G. Roman Reddy


Date: 8:41:39 on Fri 24 Nov 117.