CPlasFal_920


Sequence

>CPlasFal_920 (3 EST) Length=644 ATGATCTGTTCCTGATCTTTTAGTTGATTCTGTTTCATCTTTTTTTTCTTTAGATGTTATCAGCATTTCAGTTTCATTAT CAGAAAGTTTATTAGTATATATATCGCCATGCTTTGTAGGTTTAATATCGACGAGTCTATTAGTTTTTTGCTCTAAACTA TCGTTAACAAGTTGATTTGAATGCAATATTTTTTTCTGGTTTTCTTCGTATTCCTTTATAATTTCATTAAGTTCACGTNT CAAATTAAGATATAATTGATTTTTTAATGAGTTCAATATATTTGTTTTCAATTGTGTCTCATTATCTTTTATGACCTCAT CATTTTTATTTAATAGACTATCTATTTTTAACGATAATATATTTTGTAAATGTTTTAACCATTTCTGTTCCAAACTATGT CTAAGTTTTATATCTTTGTTTTTTATTATTTCATCTTTTTCTTTTGTTAGTTCATCCTTTATTATTTTCACCATATCAGA TTCTAGTTTACTTTTTATGTGTTGTTCTCTTTCTGCTAACTCGATTTTCTTTCTTTCCAGTCTTTCTTGCTCTTGTCTTT TTAATTCTTCTTCTTTTTGTAGTCGTTCTTGTTCTTGTCTTTTTAATGCTTCTTCTTTTTGTAGTCGTTCTTGTTCTTGT CTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_920: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045961674780N977621213C3czapPFDd2.1, Debopam Chakrabarti
5046231674807N977891264C3czapPFDd2.1, Debopam Chakrabarti
5048201675004N979701733C3czapPFDd2.1, Debopam Chakrabarti


Date: 1:15:55 on Tue 21 Nov 117.