CPlasFal_935


Sequence

>CPlasFal_935 (2 EST) Length=435 AATATATATATTATTTAAATTATTTTCATTCATATGTACAGGTATTTTTAATGGTTCTAAATTTTGCATAGGTGTAATAT ATACATATGTAGATATATAAATATTTTTTATAATTGGTTTAAATGGTTCCATATGAACAATTCCATATTTTTTGGATATT AATTTCAAGGATGTTGAAATATTTCCTGTTCTTATAAAATCTATAATTTTCCCATTTCTTTTTAATGATTGTTGTAAAAT ATTTTCTCCTTTTTCTATTTTTAAACTTTGTTTATTTAATATGTTTTGATTATCTTGTATATCTAAAACCATTATGTTTA TATCCTCATCATTTACATCATTTTTCCATATATCATTTTCATCAGAGAAATCGCTTTTGCCTTCGAATTTATTAACTTCA CTATTATATGATTCTTCATCTTTTTTTTTTTTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_935: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044551674639N976211063C3czapPFDd2.1, Debopam Chakrabarti
5047031674887N978691419C3czapPFDd2.1, Debopam Chakrabarti


Date: 10:30:42 on Tue 21 Nov 117.