CPlasFal_947


Sequence

>CPlasFal_947 (9 EST) Length=691 GCTAATCCATCTAAACCTTGAGTTGATTTCCCTTCACCTGTGCATGGAATGTTAACCAAACCTTTATCAACCTTAATACC TGGAATTATATTTNCATTGTGTAATAAATTAACCATTGGTACACCGGCTTCATTCTTTTGAAATAATGTTTCTTCAAATA AAATTGCTCCTGAAATGAATTTTCCTAATCCTTTAGTTCCAAATAATAAATCTCTGTAGCTAGCTCTGTTTTCTATTGTG TTCTCTAATTTGATGTTGTCGAATCTTTTCTTAATGGTTTGTGTTGATTCATCAGCAGCTAAAATTCCCTTTCCAGCTTG AACAAGCTTTTGGGCGGTGGTTGCTAATTCTTCGGCAACATCTGCTGGTAATTTTTTTGGGGCATTCATATATTCAGTGC AATGAGCCATTTTCAAAATAATATTATATCAAATGCTAAAAAGAATATTCAAAAAAAAAATTCGGTGATGGTGTTTTTAG GTATATAAAAAAATAAAAATTTCTTTATTATATATTTTGTTAGTATATATATTTATAAAATAATATATAAAATATATATT TATTAAAAATGTTTTTAATAAATCTAAAAAAATATATTTTACTTCGAGAATATTCCCTTTATTTTTATTTTATTTTAATT ATTATTATTTTTTTTTCTCTTATTTTTTTTTCATTAATTTACTCTCGTGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CPlasFal_947: (9 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44141462888T181020620c3czapPFDd2.1, Debopam Chakrabarti
44214462961T181750779c3czapPFDd2.1, Debopam Chakrabarti
44225462972T181860793c3czapPFDd2.1, Debopam Chakrabarti
44252462999T182130827c3czapPFDd2.1, Debopam Chakrabarti
5044581674642N976241066C3czapPFDd2.1, Debopam Chakrabarti
5044951674679N976610788C3czapPFDd2.1, Debopam Chakrabarti
5045021674686N976680834C3czapPFDd2.1, Debopam Chakrabarti
5045471674731N976971129C3czapPFDd2.1, Debopam Chakrabarti
5047261674910N978921463C3czapPFDd2.1, Debopam Chakrabarti


Date: 23:47:25 on Fri 17 Nov 117.