CPlasFal_948


Sequence

>CPlasFal_948 (3 EST) Length=448 TATAACAACATGTTGAAGAACGTTGAATGAGATTATATAAATAAATTAAAAAATGAGAAGAAAGTTGTTGACGAAAAAGT TATCAGAAATGATTGGTCACAAACAAATAACAACTTGTTTTTTACATTGTACAAAAAAGAGGTTGAAGAGAAAAATTTTT TTTACTACATAAAAAATGACTACATGTCCTTAACCCTTTGGATTAACGATGACGAAATATACCATTTGGAAAAATATTTC TTTTCAAATATTATACCACAACAAACAAAAATAAACTTAACAAAGATGAAAATTGAAATAATCCTGGAAAAAGAAGTAAA AGGGGTACCTTGGGACAATTTTACAAAAATGAACAGTGATGAACATGTGACGGAGAAAAAAACATGAAGTCGTATAATCC GTTTGAACGGAACAAAGTGTAANGCATATTAAAAAAAAAAAGAAGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CPlasFal_948: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045281674712N981551093C3czapPFDd2.1, Debopam Chakrabarti
5049441675128N980782233C3czapPFDd2.1, Debopam Chakrabarti
5049881675172N981222214C3czapPFDd2.1, Debopam Chakrabarti


Date: 16:43:14 on Sat 18 Nov 117.