CPlasFal_949


Sequence

>CPlasFal_949 (3 EST) Length=405 AATAGGNGTGTATANATATTAAGAATGTATNCATGCATATATATATAGTCCAAAATTATTGAANATATTGCAAATTATTT ATTAAATAAATGTCCTCAAAAAAAAGGTATAGTTTTAAAAATATTAATAAAGACTCCAAAAAAACCAAATTCAGCTTTAA GAAAAGTTGCTAAGATAAGATTATCAAATAATAAGGAATTATTAGCATATATACCAGGTGAAGGTAAATCTATTCAAGAA CATAATTTTGTATTAATTAAAGGAGGTAGAGTAAAAGATTTACCAGGTATAAAATATAAAATAATAAGAGGTTCTTTAGA TTCAACTGGGGTTTTAAATAGAAAAACTTCTAGATCTAAATATGGAACTNAAAAATATTAAAATATATAAATAATAATGA TAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_949: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28877319613T097810368m3gmbPfHB3.1, G. Roman Reddy
28878319614T097820368m7gmbPfHB3.1, G. Roman Reddy
29059319795T099630524m7gmbPfHB3.1, G. Roman Reddy


Date: 9:32:19 on Sun 19 Nov 117.