CPlasFal_950


Sequence

>CPlasFal_950 (4 EST) Length=536 CTTAACCACTTATGCTATCTCTTGAAATACGATTCAGTACATGGTCAATTTCCATGTGAGGTAACCCACGCTGATGGATT TTTATTAATCGGAGAAAAGAAAGGCACGAGTTTTCGCTGAAAAGGATCCATCTCAAATCCCTTGGGGAAAATGCCAAGTA GATGTTGTATGTGAATCAACTGGTGTATTTTAAACCAAAGAATTAGCTAGCAGTCACCTTAAGGGAGGAGCCAAGAAGGT TATTATGTCCGCCCCACCAAAGGATGACACCCCAATTTATGTTATGGGTATTAACCACCACCAATATGATACCAAACAAC TTATTGTTTCCAATGCATCATGTACCACAAACTGCTTAGCTCCATTAGCTAAAGTTATTAATGATCGTTTTGGAATTGTT GAAGGTTTAATGACCACCGTTCATGCATCCACTGCTAACCGAATTAGTTGTTGATGGGTCCATCAAAGGGTGGTAAGGAC TGGAGAGCAGGTAGATGTGCATTATCCAACATTTATTCCCAGCTTTCCACCTGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_950: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
26621163938T024820071C3cbsPfHB3.1, Debopam Chakrabarti
44063462810T180240371c3cbsPfHB3.1, Debopam Chakrabarti
44078462825T180390394c3cbsPfHB3.1, Debopam Chakrabarti
5044431674627N976091046C3czapPFDd2.1, Debopam Chakrabarti


Date: 2:38:25 on Thu 23 Nov 117.