CPlasFal_954


Sequence

>CPlasFal_954 (3 EST) Length=1028 TATATTTTATTATTTATTTTCCCCCTGTTAGGTCAAAGGAAGGGTAGAGGCTCTATTTTCAAGTCTCATAATCATCATAG AAAGGGCGCANAAAATTACGCCATTTAGATTATTGTGAAAAAAAAGGATATATAAAGGGTTTGGTAAAGGATATCATACA TGACCCAGGAAGAGGTGCTCCTTTAGCCAAGGTAATATTTAAAAGAACAGAAAAGTATGGAAAGAAAGAAGAATTAATTA TAGCTTCAGAAGGTATGTTTACTGGTCAATATATTTCATGTGGTACGAAAGCCCCCTTATCAGTAGGTAATATTTTACCT ATTGGAAAAATGCCTGAAGGGTACCTTAATATGTAACTTAGAACATAGAACAGGGAAATAGAGGAACCTTAGTAAAAGCT TCCGGATGTTATGCTACTGTTGTAGGTCAATCAGAAGATGGAAAAAAAACTAAAGTTAGATTACCATCAGGAGCTAAAAA AACTATCGACGCTAAAGCTAGAGCTATGGTAGGTGTTGTAGGTGCAGGTGGACGTATAGATAAACCTATATTAAAAGCTG GTGTTGCTCACCACAAATACAGAGTCAAGAGAAATTGCTGGCCTAAGGTTAGAGGTGTAGCCATGAACCCTGTAGAACAT CCTCATGGTGGTGGTAACCATCAACACATTGGTCATCCTTCTACCGTTTCCAGAAGTGCACCTGCAGGACAAAANGGTTG GTTTGATTGCTGCCAGAAGAACAGGTTTATTAAGAGGTGCAAAGAAAACCAAATTGGTTGGAAAATCTGAAGAATAAGCA ATTAAAAATGAACCATATGTAAGATTNAAATGTGAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAGGAAAGGAACAAA CAAAGAAAGAAAGAAGGAAATAAAAGAGTAAAAGATTTTAAATAGGAAGATAAAAAAAATTATTTAAAAATTTTTGATAT CAAAAGAAAGAAATGTTCATCTTGAAAAAATATATCACCATGAATATGTATATGTATATATATATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_954: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28903319639T098070390m3gmbPfHB3.1, G. Roman Reddy
28904319640T098080390m7gmbPfHB3.1, G. Roman Reddy
12002182320460AA5502081326m3gmbPfHB3.1, G. Roman Reddy


Date: 17:21:45 on Wed 22 Nov 117.