CPlasFal_958


Sequence

>CPlasFal_958 (2 EST) Length=439 GGAAACAAACCATTTGAACATTTTAATAGTCCTAATTTCGAAAATATGATGAAAGGAGTTTTTGGAATTATTCAAAATCC TTTTGAAAATGGCCAACCCACTTTCCCATTCTTTAAAAATATTAATTCGATCTCTGGAATCGGTAATCTTGATATCCCCA AAAATTTTATGAATGATTTTTTGAATAATGGAAATGATCAAAACACACCAATATCGAGCTAAATGCCGGACAATTAATAG GACCAATTTGATTTATGTTAACATAAAAATATATATATGTGGGTAAATATAAATAAATAAATAAATAAATATATATATAT GTATATATTTATATATTATATTTATGTATATATATATATATATGTGCATATATAATATACAAAACCGTATAAGAGTTCAA AAAAAAGGTATAGTTACAANAAAATAAAAACCTCGTGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CPlasFal_958: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044771674661N976430752C3czapPFDd2.1, Debopam Chakrabarti
5048431675027N979932011C3czapPFDd2.1, Debopam Chakrabarti


Date: 15:54:4 on Fri 17 Nov 117.