CPlasFal_971


Sequence

>CPlasFal_971 (2 EST) Length=377 TATATATAACTTATTATCCACTTTCTTAGATTTTTCTTTAAAATCTCTTACTCATATACACCACTTGCTTGAATAATTTC ATCTTCCTTTTTATGATCCTGAGGAAATATAATAAAATAAATCAATATAAAAATAATTAAGGTTTCTATATATAATACAT TTTGTATATTTACTATATGAGGAGTTGAGTTAAAATCTCCTATTAATAATAAAGGAATAAAAGGAATATCTTGAACAGTG TTTTGTATAAATTCATAGAAATCTCTTATGATTAAATATGCGTGATATAATTTTATATCAGGATATAATGGGATTCCACA TGATATATGACAATTACCAAATTCCCTAAGGTATGGTTTGCCTTTGGAATAAATCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_971: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28649319385T095530159m3gmbPfHB3.1, G. Roman Reddy
28650319386T095540159m7gmbPfHB3.1, G. Roman Reddy


Date: 16:16:33 on Sat 18 Nov 117.