CPlasFal_974


Sequence

>CPlasFal_974 (3 EST) Length=560 AAGTTGATGTAAGAAAGTATTTGATAAATGAAAAGGAAACCCCATTTACTAATATACTAATACATGCGTATAAAGAACAT AATGGAACAAACTTAATAGAAAGTAAAAACTACTCATTAGGATCAGACATTCCAGAAAAATGTGATACCTTAGCTTCCAA TTGCTTTTTAAGTGGTAATTTTAACATTGAAAAATGCTTTCAATGTGCTCTTTTAGTAGAAAAAGAAAATAAAAATGACG TATGTTACAAATACCTATCTGAAGATATTGTAAGTAAATTCAAAGAAATAAAAGCTGAGACAGAAGATGATGATGAAGAT GATTATACTGAATATAAATTAACAGAATCTATTGATAATATATTAGTAAAAATGTTTAAAACAAATGAAAATAATAATAA TAGTCATGATAATAATAAAGATCTAGAACAAGTAGAGGATAGTTCTAGCACATATAATAAGAAAGGGNAAAAAAAAATTT ATATTACAGTTACTATATTACAAGCACTCGTTTTATTATTNTTCANTAAAAAAAATGAATATCATATTAACGGTAATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_974: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44207462954T181680766c3czapPFDd2.1, Debopam Chakrabarti
5044301674614N975961029C3czapPFDd2.1, Debopam Chakrabarti
5046201674804N977861257C3czapPFDd2.1, Debopam Chakrabarti


Date: 2:27:54 on Mon 20 Nov 117.