CPlasFal_991


Sequence

>CPlasFal_991 (2 EST) Length=373 ATTTCATATGTTTATATATATTTATACCTTTGTACTTCTTTTATATTTAGAAATTGATAAGATTGTGTAATTTGAGAGAT ACGTATATAAAAAAGTTTCAAGATATCGACACTTGCCTTGTAGAAAGTAAATCATTAAATAAAAATTACAAGAGCAAAAA TATAGATGATTATGAATCTTCAGAACCTATATATAATCCTTATAATGTCAAAATATTAAAGAATTGTAATGCCTTCATCA ATTTTGTCGACGGCATATTTTTTGTTCATTGGGATCCGCATACGGATGAAGGACCTTCAAGTAAGAAACATAATATTGCG TTTAACTAAAAATATGAAAAAATACGTTCTTGTAAAAAAAAAAAAAAAAAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_991: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2827319164T026450016M3gmbPfHB3.1, G. Roman Reddy
12000472320289AA5500371116m3gmbPfHB3.1, G. Roman Reddy


Date: 9:38:42 on Thu 23 Nov 117.