CPlasFal_999


Sequence

>CPlasFal_999 (2 EST) Length=471 TTACTAGTAATAAAATGTAATAAGAGTATCAAGAAAAGGTGCGAATTATGTTTTGACGTATTGTTCAAATTGATAGAAAT GAAACACAAGGAATGCTATAACAAGTCAAAAGAAAAAAATTTATTATGTCATAATGATATAAATAAAGGGGAAATACACA GACATATATATTATCAACTATATAAATTAAATGAACATATTAAAGAAAATAATATTGAAAAAGATTTTAAAGAACCTTTG CATATTACTATATCAGGTTCGCTTAATTTGAAAAGATATATGATTAATTCCTTTATTAATAAAATAAAAGAGGAATTGAA AAATCAAAACAGGTAAAAAAAAAATAAACAAATTAAACTTGAAATATATATATATTTATTTTATTTTTAGTTCCTTCATT ATTTTTTTATTTATGAGGATAAGAGAAAGAAAAATAAGATAATTCATAAATAAATAAATAAATAAATAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_999: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049111675095N978372127C3czapPFDd2.1, Debopam Chakrabarti
11999822320224AA5499721049m3gmbPfHB3.1, G. Roman Reddy


Date: 17:17:33 on Fri 24 Nov 117.