CShisMan2_1000


Sequence

>CShisMan2_1000 (7 EST) Length=424 TCTCGATGGGGTTCTCCGAAGTGATATTGAGAAAGGAAAGAAGCTATTCGTTCAGAGATGTAGTCAGTGTCATACCGTCG AGAAGGGTGGTCCTCACAAAGTGGGACCCAACTTAAGTGGTCTGTTTGGTCGTAAAACTGGTCAAGCTCCTGGGTATACC TACACTGCTGCCAACATAAGTAAAGGTATCATATGGAATGAGCAGTCTCTATTTGAGTATTTGGAAAATCCGAAAAGTTT ATCCCTGGTACAAAGATGGTCTTTGCTGGTTTAAAGAAAGACACTGATCGCAATGATATCATTTCCTACCTTAAAGAAGC AACAAAATAAGAATATTCTAAATATCTGATTTCTAGATTTTACTTTGTTGTAGCAGTTCTTTAATTAACTTGATATGTAT AGAAACATAAAGCCTGAGCTTCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1000: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824391713277AA143872MCCE0255.M1RSchistosoma mansoni, cercariae
12097922330081AA559385MC260325.NA3TBRI-Saber-cercaria-A
12101792330468AA559772MC210217.NA3TBRI-Saber-cercaria-A
12165872338836AA566204MC3NE024.ACSS. mansoni cercarial Lambda Zap
15900282956652AA864173SMTBCEA000036SKSchistosoma Lambda Zap II cercariae
16452133056546AA917152SMTBCEA000115SKSchistosoma Lambda Zap II
16891863116555AA952849SMTBCEA000520SKSchistosoma Lambda Zap II cercariae


Date: 23:40:51 on Fri 17 Nov 117.