CShisMan2_1002


Sequence

>CShisMan2_1002 (40 EST) Length=651 CACAATGCCTTTCCATATTGGCGACAAAAGCGGTCATTTCGATGCCAACCAAAACAGATTCAATCTTCAAGATCCAGGTT TCGGGCCAAGTGAAGGTGTTTACAATAATCGCATGGACCCTCGATATGGCAATATGAATCCAAACTATTACGGTGGGGTG CCTGGAACATTTGGAGGAAATGGGATGTACGGACAGAACATCTATAATCAGCAACCAGGCTCTCAAGCCTGGAATGCGGG AAGACNACATTTAAATGGCTCGGATTCGGATGACTCTGACATTGATAAACGCAATTTCAGAGGTTCAGGACCGGGTTGGA ATCAGGGACNACATGGTTCACATTCAAATCGACGTGGTCACTCTAGCGATCGTGGTTCAAGTTCAGATGAAGGAAGGCGT AACAGACATTGGCGCTAGAGAAATTTTGTCAATGTTTATCTGGTCCGTGTTCTTTCTGAACATTTGTCACTATTGATTTT TGATATTACCTTTTATTCAAAGAAATCTATAAAATGAATGAAATACAATTAGAATGTGCTTATTCGATATTTACTTACGT TTTGGTTGATTTGTTTTTTTTAATATTGTGAAATACACTTTCTATATTCGTCTTCAAAAAAAAAAAAAAAAACTCCTCGT GCCGCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_1002: (40 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7823801713218AA143813MCCE0108.M1FSchistosoma mansoni, cercariae
7823861713224AA143819MCCE0116.M1FSchistosoma mansoni, cercariae
7824611713299AA143894MCCE0282.M1RSchistosoma mansoni, cercariae
7824621713300AA143895MCCE0283.M1RSchistosoma mansoni, cercariae
12097902330079AA559383MC260320.NA3TBRI-Saber-cercaria-A
12098842330173AA559477MC260480.NA3TBRI-Saber-cercaria-A
12098862330175AA559479MC260485.NA3TBRI-Saber-cercaria-A
12099132330202AA559506MC280404.NA3TBRI-Saber-cercaria-A
12099372330226AA559530MC070521.NA3TBRI-Saber-cercaria-A
12099482330237AA559541MC070537.NA3TBRI-Saber-cercaria-A
12099982330287AA559591MC080519.NA3TBRI-Saber-cercaria-A
12100292330318AA559622MC090706.NA3TBRI-Saber-cercaria-A
12100542330343AA559647MC240705.NA3TBRI-Saber-cercaria-A
12100622330351AA559655MC240724.NA3TBRI-Saber-cercaria-A
12100712330360AA559664MC180908.NA3TBRI-Saber-cercaria-A
12100832330372AA559676MC180925.NA3TBRI-Saber-cercaria-A
12101332330422AA559726MC041001.NA3TBRI-Saber-cercaria-A
12101342330423AA559727MC041002.NA3TBRI-Saber-cercaria-A
12101542330443AA559747MC140323.NA3TBRI-Saber-cercaria-A
12101642330453AA559757MC140337.NA3TBRI-Saber-cercaria-A
12101852330474AA559778MC210237.NA3TBRI-Saber-cercaria-A
12101872330476AA559780MC210246.NA3TBRI-Saber-cercaria-A
12101962330485AA559789MC250447.NA3TBRI-Saber-cercaria-A
12102192330508AA559812MC250484.NA3TBRI-Saber-cercaria-A
12102222330511AA559815MC250495.NA3TBRI-Saber-cercaria-A
12102232330512AA559816MC250497.NA3TBRI-Saber-cercaria-A
16099862992135AA883024SMTBCEA000053SKSchistosoma Lambda Zap II cercariae
16452203056553AA917159SMTBCEA000128SKSchistosoma Lambda Zap II
16452233056556AA917162SMTBCEA000134SKSchistosoma Lambda Zap II
16891263116495AA952789SMTBCEA000117SKSchistosoma Lambda Zap II cercariae
16891273116496AA952790SMTBCEA000119SKSchistosoma Lambda Zap II cercariae
16891433116512AA952806SMTBCEA00000176SKSchistosoma Lambda Zap II cercariae
17368613189781AA999226MCCE3006.M1FSchistosoma mansoni, cercariae
17368913189811AA999256MCCE3053.M1FSchistosoma mansoni, cercariae
17369133189833AA999278MCCE3082.M1FSchistosoma mansoni, cercariae
17369983189918AA999363MCCE3203.M1FSchistosoma mansoni, cercariae
17370523189972AA999417MCCE3271.M1FSchistosoma mansoni, cercariae
17372663190186AA999631MCCE3643.M1FSchistosoma mansoni, cercariae
17372803190200AA999645MCCE3670.M1FSchistosoma mansoni, cercariae
17372913190211AA999656MCCE0238.M1FSchistosoma mansoni, cercariae


Date: 3:53:46 on Sun 19 Nov 117.