CShisMan2_1004


Sequence

>CShisMan2_1004 (3 EST) Length=345 AGATAAGGAACATTTCTATTCGTAGAGGAATAACATTGAGAAAATATTGTGATTCAGATTGCGAAATAAAAAATCTAGTC AATATTACTGAGATTTAATAACATCCTATTCACATTTCTGAGAAACGTAAAAGTAGCCTGAAGGTCATTTGGACCACTTA ACCACCCTCCTTTCGTAAACGAATTGATTAATTGGCTCCTTTGATCCAATAGGTAAAGTGGCCAAATAGAAAGGTGTATC AGCACCCTCATCAGCTGTTTTGGTTCCCTTGTGACTAGTCATATCAGTATCGCAATAACCAGGACAACACGAATTTATCA CAATCTCTCTTGGATCATCTTTCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1004: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39331514725T14558SMEST0219Schistosoma mansoni, adult worm, Gloria Franco
7790901702749AA140589MEEG0126.M1FSchistosoma mansoni, egg stage
7808031705398H98281SMNHADA015082T3SmAW


Date: 17:59:24 on Tue 21 Nov 117.