CShisMan2_1010


Sequence

>CShisMan2_1010 (2 EST) Length=453 ATAAAAAGTCTAAATCCCACCAGTTGATGTCAGTTCCAGAATAAAAATAGGAGATTTTGTACCCCGGNCGGAGTAAGATA AATTGATTGACATCAGTCATTTGGATCCAACCAATATCGTGATCTGATTCAAGAAGGTATCCAACTGGCAGAAAAACTTC TCACTGGCAAGTTGACAAAAGCACAATATCAGTCCTCAAATGACGATTTATGTTTCTAAGAAAGCTGATATAATCCTACA GAATAGATTNCAATATTGGAATGTCTCTAGCACTAANCGAATAGGATTNCATGAGTATAACTTTTTGTGTTGACTTTATT TTTAGTCCTTACCACCGTGTGCGATTACGTGTTTCGTTAATTTTTTCTACTATTTGCGTTTTTCTTTTAATATAAGACAT TGGATAAAAAAAAAAAAAAAAAAAAAAAAAACATGCCATGCAGCTGCATTACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_1010: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4350761154100N33701SMNHADA019065SKSmAW
15417662889778AA819935MF5MA182.AM3S. mansoni female adult Lambda Zap


Date: 13:16:41 on Wed 22 Nov 117.