CShisMan2_1020


Sequence

>CShisMan2_1020 (4 EST) Length=537 ACCAAAAGTGGAAAGTTATACTCGAAGTTAAGAATAGTATACAATGTGGGTGGATTCATTTACTCAACTTATTTACTAGC ACATACACAAAGTTTCTGAAAAAAGAAAAAGAAAAAAGAAAATTGGCTAGAATTAAAGCAACAAAGATGTAAAAAAATTT TAATATATGGCAACAACTCGAAAGTGAAAAATAAGCATTTCCTATTTGTTCACTTTAAACAAGAAAAAAAAGGACCTTTA TTCTTAAATACCGAAAGTAGTCTACATTTACAAGAGAAAAAAACAAGTTGAGAAAATTAATAGAAACAATTTTAAAAACT TTCAATGAAAGTATAAGGAAGGTCATATATATGTGTAATTATTATGATGAACGCACTTTGATCGGTTTTCGTCGTTTTAA TTCTTTTTGTTGTGGATTCTGATCAGTTTCAGTTTGATCACTAGTCTCTCNCTCGTGCCGNNTAACTGCAGCCCGGCTCC TTTTTCCGCTGTCCAGAATCTTGACTAGTAAAGAACCACTCTTTAGAAGTATGTAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1020: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190051126892N21722SMNHADA00E024SKSmAW
4291961145922N28066EST000024S. mansoni cDNA
11826592160116L81253SCMRAP0373C2/S1 day seven schistosomula mini-library
17370243189944AA999389MCCE3234.M1FSchistosoma mansoni, cercariae


Date: 8:17:57 on Wed 22 Nov 117.