CShisMan2_103


Sequence

>CShisMan2_103 (3 EST) Length=612 ATTCAGTATTACTATGATGAGAAAGTGGGTAGATATAGTCAGTGATCACTTTTTGTCACCCTTAGGAGAAGCAGTATCCT TTTCGCCTTCACTATTTGAGGTCCAAAGTGTAAGATTATCCCTTAATAGTTGCATAATTATTGTTGAATCTTTGTAACTT TCTTCCGATAACGTATCTAGTTCAGCAATAGCCGAATCAAACGCTACTCTTGCACATTTGCACGCTTGTTCAGAGTTATT AAGAATTTCATAATAAAACACTGAGAAGTTTAGGGCAAGACCTAGTCGAATAGGATGAGTAACAGGAAGTTTCTCAGCGT CCTCTGCCGCTTTTTTATATGCACAAAGACTGTTTTCGGCCGCATCTTTTCTTTGATTCCCAACAGAATACTCGGCTCTA TAACGATGGTAATCGCCTCTCATTTTATTTAAGAAGACTTTTGATTCGTCTGAAACAGCTTTTGGCAACAGGCAGTTATC CAGAAGGTTCAAAATACTCGTGCATATTTCGTCTAACTCTTTTTCCACTTCTTTTCGAAATCGCTTGGTTATATGTATTT CGTCTGATCCCTTAGCTTCATCTTGGCTCTCCTTTGAATTTATTATTCTCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_103: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146853385045AI067078EST208748Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155793385939AI067972EST209661Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155823385942AI067975EST209664Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 21:4:57 on Sun 19 Nov 117.