CShisMan2_1040


Sequence

>CShisMan2_1040 (2 EST) Length=384 GGGATCTGGTACATCTATGTTAATACAGCCAACGACCCCATCTGTATCAACGACATCCCAATCAAATGTGTCATCAGAAC CAACTACAACTCTGGAATCAGGGTTAACAGNAAATAAATTGGGATCTGGTGCATCTATGTCAATACAGCCNACAACCCCA TCTGTATCNACNACAGAAACAGANCTACGGTTACGGAANCCTTACAGTCTGAAACAGAAACTAGNTCACATAATGGAATG GACAGTGTATTTATTGNATTAAATTATATAACATCATTGGAATAACTATTTAAACAAGTTGAGTTGTAATACTAAGTTAT AAAAATTTTCAATATTGTATTACAGCTATTTTTCTTATNTTCATAGAATAAATACTNTTCTACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1040: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39342514736T14569SMEST0230Schistosoma mansoni, adult worm, Gloria Franco
344953976009R95524SMNHADA018047SKSmAW


Date: 17:22:33 on Fri 24 Nov 117.